Fun with ethno-national dogwhistles (lemmy.world) I found this here: mastodon.social/ . Alt text on the other side of the link.
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml) An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
Ah yes, the two genders. (lemmy.blahaj.zone) alt text: “I was born a male, identify as a male. but according to Stouffer’s lasagna i am a family of four”
"When fascism comes to America, it will be wrapped in the flag and carrying a cross." - Sinclair Lewis, 1935 (lemmy.world)
We did it Lemmy! Perhaps this is a dark thought… but I’m wondering what the future Lemmy equivalents to “We did it Reddit!” or “Thanks for the gold kind stranger!” will be....
Fun with ethno-national dogwhistles (lemmy.world)
I found this here: mastodon.social/ . Alt text on the other side of the link.
Apparently I'm a cocaine rat. Oh wait. Adhd. Yeah that tracks. (startrek.website)
18+ rule (lemmy.fmhy.net)
Game Cube rule (telegra.ph)
Think of who you're hurting before you consider piracy. (startrek.website)
Every time I see a map (i.imgur.com)
Melania said we had food at home. (lemmy.world)
Ears rule (lemmy.blahaj.zone)
Cultural exchange (lemmy.world)
AACGTCATAGCCTGATTACCAGTAGGTACTAG (lemmy.ml)
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
no time left to post memes (lemmy.ml)
Solidarirule (lemmy.tf)
defederating from meta rules (sh.itjust.works)
Ah yes, the two genders. (lemmy.blahaj.zone)
alt text: “I was born a male, identify as a male. but according to Stouffer’s lasagna i am a family of four”
batrule (lemmy.fmhy.ml)
"When fascism comes to America, it will be wrapped in the flag and carrying a cross." - Sinclair Lewis, 1935 (lemmy.world)
We did it Lemmy!
Perhaps this is a dark thought… but I’m wondering what the future Lemmy equivalents to “We did it Reddit!” or “Thanks for the gold kind stranger!” will be....
Humanity rule (lemmy.blahaj.zone)
rul (lemmy.blahaj.zone)
fish rule (lemmy.world)
Rulestalgia (lemmy.sdf.org)
The promised rule (lemmy.blahaj.zone)
Rulegents (lemmy.blahaj.zone)
Lemmy Markdown Text Formatting Guide
Lemmy Markdown Formatting Guide...
rulenheimer (lemmy.world)